Journal: Cell metabolism

Article Title: A methionine-Mettl3- N 6 -methyladenosine axis promotes polycystic kidney disease

doi: 10.1016/j.cmet.2021.03.024

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-METTL3 Abcam ab195352 Anti-METTL3 Invitrogen MA5-27527 Anti-m 6 A Abcam ab151230 Anti-c-Myc Abcam ab185656 Anti-c-Myc Sigma OP10-200UG Anti-Avpr2 EMD AB1797P Anti-Puromycin Developmental Studies Hybridoma Bank PMY-2A4 Anti-HA Cell Signaling #3724 Anti-PCNA Santa Cruz sc-7907 Anti-pHH3 Sigma H0412 Anti-pCreb1 Cell Signaling 9198S Anti-Yap Cell Signaling #4912 Anti-GFP Aves GFP-1020 Anti-DBA Vector Laboratories B-1035 Anti-Mettl14 Sigma HPA038002 Bacterial and Virus Strains Ad-CMV-iCre virus Vector Biolabs #1045 Biological Samples Normal human and ADPKD kidney samples PKD Biomarkers and Biomaterials Core in the Kansas PKD Center at the Kansas University Medical Center (KUMC) Chemicals, Peptides, and Recombinant Proteins Puromycin Invitrogen A1113803 O-Propargyl-Puromycin JenaBioScience NU-931-5 8-Br-cAMP Sigma B7880 alamarBlue Invitrogen DAL1025 methionine Sigma M5308 s-adenosylmethionine Cayman Chemicals 13956 s-adenosylhomocysteine Cayman Chemicals 13603 Critical Commercial Assays m 6 A elisa kit Epigentek P-9005-96 SAM elisa kit Cell Biolabs STA-671-C Magna MeRIP™ m 6 A Kit EMD Millipore 17-10499 Submitted data MeRIP-seq NCBI Gene Expression Omnibus GSE165956 RNA-seq NCBI Gene Expression Omnibus GSE165956 Experimental Models: Organisms/Strains Ksp/Cre Shibazaki et al., 2008 N/A Ksp/rtTA Pan et al., 2013 N/A tetO-Cre Jackson Laboratories Stock No: 006234 Pkd1 F/F Jackson Laboratories Stock No: 010671 Pkd1 RC/RC ( PKD1 p.R3277C) Hopp et al., 2012 N/A Mettl3 F/F UT Southwestern Med Ctr N/A Mettl3 Tg UT Southwestern Med Ctr N/A mIMCD3 cells ATCC CRL 2123 Oligonucleotides siRNA against Mettl3 (UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUGUGUGA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA) Dharmacon L-049446-01-0020 Scrambled siRNAs (ACAGCAGGCACAGACAGGCAGU) Dharmacon D-001810-10-20 Recombinant DNA Plasmid - CAG-LSL-Mettl3cDNA-HA/HA/HA-IRES-GFP This paper N/A Plasmid - pLightSwitch Empty (pLS) 3′-UTR Switchgear Genomics S890005 Plasmid - pGL3 Promega E1751 Software and Algorithms Imagej NIH https://imagej.nih.gov/ij/ Zen blue software Zen https://www.zeiss.com/microscopy/us/products/microscope-software/zen-lite.html ImageLab Bio-rad https://www.bio-rad.com/en-us/product/image-lab-software?ID=KRE6P5E8Z Ingenuity Pathway Analysis (IPA) Qiagen https://analysis.ingenuity.com/pa/installer/select Prism Graphpad https://www.graphpad.com/scientific-software/prism/ Integrative Genomics Viewer (IGV) Broad Institute http://software.broadinstitute.org/software/igv/ Open in a separate window KEY RESOURCES TABLE.

Techniques: Plasmid Preparation, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Gene Expression, Software

Journal: The FASEB Journal

Article Title: Hypoxia-inducible factor 1α (HIF-1α) is a major determinant in the enhanced function of muscle-derived progenitors from MRL/MpJ mice

doi: 10.1096/fj.201801794R

Figure Lengend Snippet: ChIP assay for interactions of HIF-1α at its target genes in MRL/MpJ MDSPCs. Chromatin prepared from DMOG-treated MRL/MpJ MDSPCs was immunoprecipitated with control IgG and HIF-1α antibodies, followed by qPCR with gene-specific primers flanking HIF-1α responsive genomic sequence using ChIP DNA. A–C) Interactions of HIF-1α are indicated by % bound input: 3 regions in Pax7, the promoter region (Prom.), first intron, and 3′UTR as control region (A); the Vegfa promoter (B); and the Glut1 promoter that harbors HIF-1α –responsive genomic sequence and is indicated by a solid triangle (C). D) ChIP assay for HIF-1α occupancy at the Pax gene in CoCl2-treated MRL/MpJ MDPSCs. E) Schematic of a construct containing the 1.2-kb mouse Pax7 promoter driving the expression of Zsgreen (GFP). F, G) Fluorescent microscopic images taken after transient transfection with the Pax7-Zsgreen reporter gene in the myoblast cell line C2C12 (F) and HEK 293 cells (G), each in the presence of DMOG (1 mM) or CoCl2 (200 μM), and coexpression of mutant HIF-1α after transfection as indicated. Scale bars, 10 μm. H) Level of HIF-1α in MRL/MpJ MDSPCs after transducing with lenti-nshRNA and lenti-shRNA followed by precondition to hypoxic conditions for 24 h was analyzed with Western blot using the cell lysates. I) Quantitative gene expression showing mRNA levels of myogenic stem cell markers Pax7, Hes1, and Notch3 in nshRNA and HIF-1α shRNA MDSPCs from MRL/MpJ mice.

Article Snippet: A mouse genomic fragment spanning −1150 to +50 bp of the Pax7 gene with 2 putative HIF response elements, ACGTG, was synthesized by Integrated DNA Technologies and cloned into a pLVX-IRES-ZSgreen [green fluorescent protein (GFP)] plasmid vector (Clontech Laboratories, Mountain View, CA, USA) at Cla I and Eco RI sites.

Techniques: Immunoprecipitation, Sequencing, Construct, Expressing, Transfection, Mutagenesis, shRNA, Western Blot

Journal: Frontiers in Cardiovascular Medicine

Article Title: Multi-omics of in vitro aortic valve calcification

doi: 10.3389/fcvm.2022.1043165

Figure Lengend Snippet: Effect of ZBTB16 (PLZF) on human valve interstitial cells (VIC) osteogenic differentiation. (A) Results of Alizarine red stain of VIC cultured in standard medium (undif control), osteogenic medium (dif control), osteogenic medium with transduction by an empty vector (dif TRC), osteogenic medium with transduction by construction for ZBTB16 overexpression (dif ZBTB). (B) Results of qPCR of Zbtb16 , Runx2 , and Col1a in VIC cultured in standard medium (undif control), osteogenic medium (dif control), osteogenic medium with transduction by construction for ZBTB16 overexpression (dif ZBTB). * p -value < 0.05. (C) Clusterization by sparse partial least square discriminant analysis (sPLS-DA). (D) Volcano plot demonstrating results of analysis of differential expression by limma between VIC in osteogenic conditions and VIC in osteogenic conditions with ZBTB16 overexpression. Log 2 fold change—level of change in expression -Log 10 P—logarithm of adjusted p–value. Dotted lines cut off transcripts with adjusted p -value < 0.05 and Log 2 fold change > |1|.

Article Snippet: For overexpression we constructed plasmid for ZBTB16 overexpression by restriction cloning of full sequence of ZBTB16 to pCIG3 (pCMV-IRES-GFP version 3) plasmid purchased from Adgene (Plasmid #78264 ; accessed 07/02/2022).

Techniques: Staining, Cell Culture, Control, Transduction, Plasmid Preparation, Over Expression, Quantitative Proteomics, Expressing

Journal: Frontiers in Cardiovascular Medicine

Article Title: Multi-omics of in vitro aortic valve calcification

doi: 10.3389/fcvm.2022.1043165

Figure Lengend Snippet: Differentially expressed proteins between human valve interstitial cells (VIC) in osteogenic conditions and VIC in osteogenic conditions with ZBTB16 overexpression.

Article Snippet: For overexpression we constructed plasmid for ZBTB16 overexpression by restriction cloning of full sequence of ZBTB16 to pCIG3 (pCMV-IRES-GFP version 3) plasmid purchased from Adgene (Plasmid #78264 ; accessed 07/02/2022).

Techniques: Over Expression